RNAup - manual page for RNAup 2.5.1
RNAup [
OPTION]...
RNAup 2.5.1
Calculate the thermodynamics of RNA-RNA interactions
RNAup calculates the thermodynamics of RNA-RNA interactions, by decomposing the
binding into two stages. (1) First the probability that a potential binding
sites remains unpaired (equivalent to the free energy needed to open the site)
is computed. (2) Then this accessibility is combined with the interaction
energy to obtain the total binding energy. All calculations are done by
computing partition functions over all possible conformations.
RNAup provides two different modes: By default RNAup computes accessibilities,
in terms of the free energies needed to open a region (default length 4). It
prints the region of highest accessibility and its opening energy to stdout,
opening energies for all other regions are written to a file.
In interaction mode the interaction between two RNAs is calculated. It is
invoked if the input consists of two sequences concatenated with an
"&", or if the options -X[pf] or -b are given. Unless the -b
option is specified RNAup assumes that the longer RNA is a structured target
sequence while the shorter one is an unstructured small RNA.
Additionally, for every position along the target sequence we write the best
free energy of binding for an interaction that includes this position to the
the output file. Output to stdout consists of the location and free energy,
dG, for the optimal region of interaction. The binding energy dG is also split
into its components the interaction energy dGint and the opening energy dGu_l
(and possibly dGu_s for the shorter sequence).
In addition we print the optimal interaction structure as computed by RNAduplex
for this region. Note that it can happen that the RNAduplex computed optimal
interaction does not coincide with the optimal RNAup region. If the two
predictions don't match the structure string is replaced by a run of
"." and a message is written to stderr.
Each sequence should be in 5' to 3' direction. If the sequence is preceded by a
line of the form
> name
the output file "name_ux_up.out" is produced, where the "x"
in "ux" is the value set by the -u option. Otherwise the file name
defaults to RNA_ux_up.out. The output is concatenated if a file with the same
name exists.
RNA sequences are read from stdin as strings of characters. White space and
newline within a sequence cause an error! Newline is used to separate
sequences. The program will continue to read new sequences until a line
consisting of the single character @ or an end of file condition is
encountered.
-
-h, --help
- Print help and exit
- --detailed-help
- Print help, including all details and hidden options, and
exit
- --full-help
- Print help, including hidden options, and exit
-
-V, --version
- Print version and exit
- Below are command line options which alter the general
behavior of this program
-
-C, --constraint
- Apply structural constraint(s) during prediction.
(default=off)
- The program first reads the sequence(s), then a dot-bracket
like string containing constraints on the structure. The following symbols
are recognized:
- '.' ... no constraint for this base
- 'x' ... the base is unpaired
- '<' ... the base pairs downstream, i.e. i is paired with
j > i
- '>' ... the base pairs upstream, i.e. i is paired with j
< i
- '()' ... base i pairs with base j
- '|' ... the corresponding base has to be paired
intermolecularily (only for
- interaction mode)
-
-o, --no_output_file
- Do not produce an output file. (default=off)
- --no_header
- Do not produce a header with the command line parameters
used in the outputfile. (default=off)
- --noconv
- Do not automatically substitude nucleotide "T"
with "U". (default=off)
-
-u, --ulength=length
- Specify the length of the unstructured region in the
output. (default=`4')
- The probability of being unpaired is plotted on the right
border of the unpaired region. You can specify up to 20 different length
values: use "-" to specify a range of continuous values (e.g.
-u 4-8) or specify a list of comma separated values (e.g. -u
4,8,15).
-
-c, --contributions=SHIME
- Specify the contributions listed in the output.
(default=`S')
- By default only the full probability of being unpaired is
plotted. The -c option allows one to get the different
contributions (c) to the probability of being unpaired: The full
probability of being unpaired ("S" is the sum of the probability
of being unpaired in the exterior loop ("E"), within a hairpin
loop ("H"), within an interior loop ("I") and within a
multiloop ("M"). Any combination of these letters may be
given.
-
-w, --window=INT
- Set the maximal length of the region of interaction.
(default=`25')
-
-b, --include_both
- Include the probability of unpaired regions in both (b)
RNAs. (default=off)
- By default only the probability of being unpaired in the
longer RNA (target) is used.
-
-5, --extend5=INT
- Extend the region of interaction in the target to some
residues on the 5' side.
- The underlying assumption is that it is favorable for an
interaction if not only the direct region of contact is unpaired but also
a few residues 5'
-
-3, --extend3=INT
- Extend the region of interaction in the target to some
residues on the 3' side.
- The underlying assumption is that it is favorable for an
interaction if not only the direct region of contact is unpaired but also
a few residues 3'
- --interaction_pairwise
- Activate pairwise interaction mode. (default=off)
- The first sequence interacts with the 2nd, the third with
the 4th etc. If activated, two interacting sequences may be given in a
single line separated by "&" or each sequence may be given
on an extra line.
- --interaction_first
- Activate interaction mode using first sequence only.
(default=off)
- The interaction of each sequence with the first one is
calculated (e.g. interaction of one mRNA with many small RNAs). Each
sequence has to be given on an extra line
-
-S, --pfScale=DOUBLE
- Set scaling factor for Boltzmann factors to prevent
under/overflows.
- In the calculation of the pf use scale*mfe as an estimate
for the ensemble free energy (used to avoid overflows). The default is
1.07, useful values are 1.0 to 1.2. Occasionally needed for long
sequences. You can also recompile the program to use double precision (see
the README file).
-
-T, --temp=DOUBLE
- Rescale energy parameters to a temperature in degrees
centigrade. (default=`37.0')
-
-4, --noTetra
- Do not include special tabulated stabilizing energies for
tri-, tetra- and hexaloop hairpins. (default=off)
- Mostly for testing.
-
-d, --dangles=INT
- Specify "dangling end" model for bases adjacent
to helices in free ends and multi-loops. (default=`2')
- With -d2 dangling energies will be added for the
bases adjacent to a helix on both sides in any case.
- The option -d0 ignores dangling ends altogether
(mostly for debugging).
- --noLP
- Produce structures without lonely pairs (helices of length
1). (default=off)
- For partition function folding this only disallows pairs
that can only occur isolated. Other pairs may still occasionally occur as
helices of length 1.
- --noGU
- Do not allow GU pairs. (default=off)
- --noClosingGU
- Do not allow GU pairs at the end of helices.
(default=off)
-
-P, --paramFile=paramfile
- Read energy parameters from paramfile, instead of using the
default parameter set.
- Different sets of energy parameters for RNA and DNA should
accompany your distribution. See the RNAlib documentation for details on
the file format. When passing the placeholder file name "DNA",
DNA parameters are loaded without the need to actually specify any input
file.
-
--nsp=STRING
- Allow other pairs in addition to the usual AU,GC,and GU
pairs.
- Its argument is a comma separated list of additionally
allowed pairs. If the first character is a "-" then AB will
imply that AB and BA are allowed pairs. e.g. RNAfold -nsp
-GA will allow GA and AG pairs. Nonstandard pairs are given 0
stacking energy.
-
-e, --energyModel=INT
- Set energy model.
- Rarely used option to fold sequences from the artificial
ABCD... alphabet, where A pairs B, C-D etc. Use the energy parameters for
GC ( -e 1) or AU (-e 2) pairs.
If you use this program in your work you might want to cite:
R. Lorenz, S.H. Bernhart, C. Hoener zu Siederdissen, H. Tafer, C. Flamm, P.F.
Stadler and I.L. Hofacker (2011), "ViennaRNA Package 2.0",
Algorithms for Molecular Biology: 6:26
I.L. Hofacker, W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P. Schuster
(1994), "Fast Folding and Comparison of RNA Secondary Structures",
Monatshefte f. Chemie: 125, pp 167-188
R. Lorenz, I.L. Hofacker, P.F. Stadler (2016), "RNA folding with hard and
soft constraints", Algorithms for Molecular Biology 11:1 pp 1-13
U. Mueckstein, H. Tafer, J. Hackermueller, S.H. Bernhart, P.F. Stadler, and I.L.
Hofacker (2006), "Thermodynamics of RNA-RNA Binding",
Bioinformatics: 22(10), pp 1177-1182
The energy parameters are taken from:
D.H. Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J. Schroeder, J. Susan, M.
Zuker, D.H. Turner (2004), "Incorporating chemical modification
constraints into a dynamic programming algorithm for prediction of RNA
secondary structure", Proc. Natl. Acad. Sci. USA: 101, pp 7287-7292
D.H Turner, D.H. Mathews (2009), "NNDB: The nearest neighbor parameter
database for predicting stability of nucleic acid secondary structure",
Nucleic Acids Research: 38, pp 280-282
Output to stdout:
In Interaction mode RNAup prints the most favorable interaction energy between
the two sequences to stdout. The most favorable interaction energy (dG)
depends on the position in the longer sequence (region [i,j]) and the position
in the shorter sequence (region[k,l]): dG[i,j;k,l]. dG[i,j;k,l] is the largest
contribution to dG[i,j] = sum_kl dG[i,j;k,l] which is given in the output
file: therefore dG[i,j;k,l] <= dG[i,j].
'....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8'
> franz
GGAGUAGGUUAUCCUCUGUU
> sissi
AGGACAACCU
dG = dGint + dGu_l
(((((.((((&)))).))))) 6,15 : 1,10 (-6.66 = -9.89 + 3.23)
AGGUUAUCCU&AGGACAACCU
RNAup output in file: franz_sissi_w25_u3_4_up.out
where the result line contains following information
RNAduplex results [i,j] [k,l] dG = dGint + dGu_l
(((((.((((&)))).))))) 6,15 : 1,10 (-6.66=-9.89+3.23)
Output to file:
Output to file contains a header including date, the command line of the call to
RNAup, length and names of the input sequence(s) followed by the sequence(s).
The first sequence is the target sequence. Printing of the header can be
turned off using the -nh option.
The line directly after the header gives the column names for the output:
position dGu_l for -u 3 dGu_l for -u 4 dG
# pos u3S u3H u4S u4H dG
where all information refers to the target sequence. The dGu_l column contains
information about the -u value (u=3 or u=4) and the contribution to the free
energy to open all structures "S" or only hairpin loops
"H", see option -c. NA means that no results is possible (e.g.
column u3S row 2: no region of length 3 ending at position 2 exists).
# Thu Apr 10 09:15:11 2008
# RNAup -u 3,4 -c SH -b
# 20 franz
# GGAGUAGGUUAUCCUCUGUU
# 10 sissi
# AGGACAACCU
# pos u3S u3H u4S u4H dG
1 NA NA NA NA -1.540
2 NA NA NA NA -1.540
3 1.371 NA NA NA -1.217
4 1.754 5.777 1.761 NA -1.393
5 1.664 3.140 1.811 5.800 -1.393
If the -b option is selected position and dGu_s values for the shorter sequence
are written after the information for the target sequence.
Ivo L Hofacker, Peter F Stadler, Ulrike Mueckstein, Ronny Lorenz
If in doubt our program is right, nature is at fault. Comments should be sent to
[email protected].